Prove what your assay detects — and what it doesn't.

Your assay didn't change. The database did. BLASTseq AI runs live BLAST alignment, scores each mismatch by position and hybridization potential, checks every oligo in your panel against every other, and returns a versioned, timestamped record of inclusivity, exclusivity, and variant impact. Any target. Any assay. IVD or LDT.

Run a sample analysis
20+ hrs
saved per assay
<3 min
per report
Every run
versioned and timestamped
How every run is documented →
primer_probe_alignment.aln analysing
QUERYACGTTGCACCTAGGATCGTACGTTAGC
 |||||||| |||||| ||| |||| |||||
MZ272079ACGTTGCACCTAGGATCATACGTTAGC
PV810227ACGTTGCACCTAGGATCATACGTTAGC
MK390870ACGTTGCACCTAGGATCGTACGTTAGC
HF930495ACGTTGCACCTAGGATCGTACGTTAGC
Primer / probe 1,284 detected 2 mismatches
INCLUSIVITY
99.4%
DETECTION RATE
1,284/ 1,292
See it in action

Watch BLASTseq AI run a full analysis

From sequence input to analysis reports in minutes - see the complete in silico workflow.

BLASTseq AI demo video BLASTseq AI demo · 2 min
Capabilities

Everything your in silico workflow requires — minus the manual work

Design. Verify. Document. In minutes, not days.

01

Automated BLAST + Binding Specificity Scoring

BLASTseq AI queries live NCBI databases and evaluates every hit on three dimensions: sequence identity, the way BLAST always has; mismatch location impact; and hybridization ΔG°T, the thermodynamic measure that predicts real-world binding better than percent identity alone. These resolve into a single call per hit — with the contributing factors shown, so you can explain why a hit was called non-detecting.

02

Inclusivity & Exclusivity Verification

Evaluate every primer and probe against curated inclusivity and exclusivity sets in one pass — target strains and clades, related species, near neighbors, background flora, population variant sets, or whatever your assay has to discriminate against. Get an amplification score per target with the thermodynamic and alignment data behind it, not a hit table you have to interpret yourself.

03

Multiplex Panel Dimer & Cross-Hybridization Check

Running more than one primer-probe set in the same reaction? BLASTseq AI checks every pair in your panel against every other for dimer formation and cross-hybridization risk — from a 4-plex qPCR to a several-hundred-amplicon NGS panel, where the pairwise combinations stop being something anyone checks by hand. It's the failure mode that shows up in the wet lab, not in a single-primer BLAST search.

04

Variant Impact & Dropout Risk

Identify mutations, insertions, and deletions across matched sequences, and see which ones actually change assay performance versus which are silent. Catch the population SNP sitting under a primer binding site that causes allele dropout — and the false homozygous call that follows it — alongside the clade-associated polymorphism that quietly drops your inclusivity by two percent. Grouped by impact, so you're not scrolling a hundred near-identical rows to find the one that matters.

05

Versioned, Timestamped, Citable Records

Every run compiles into a structured record: inclusivity and exclusivity calls, dimer and cross-hybridization risk, variant impact, the reasoning behind each score, and the reference-database release and search date the analysis ran against. Reproducible, attributable, and formatted to export straight into design and development files, a verification package, or a CLIA validation packet.

Explore the output

See what BLASTseq AI produces

Every run delivers structured, interrogable output — from raw alignments to detection groups, inclusivity and exclusivity summaries, and variant impact. Switch samples to see the same workflow on pathogen ID, germline carrier screening, and a resistance marker.

Pathogen identification Candida auris species identification with clade-stratified inclusivity and close-Candida exclusivity.

Candida auris identification

Static preview of a species-identification run across the C. auris clades and the Candida haemulonii complex.

TargetC. auris
RegionITS / D1-D2
RecordVersioned
Analysis typePathogen identification
TargetCandida auris ID
StatusComplete
RecordVersioned · timestamped
Primary resultCandida auris species identification with clade-stratified inclusivity and close-Candida exclusivity.
Clade-aware alignments

Alignments expose mismatch position and the contributing factors behind each explained call.

ViewBase by base
CallComposite
FactorsVisible
SequenceIdentityCover
Query sequenceACGTACGTGCTATGCAA100%
Candida auris ID targetACGTACGTGCTATGCAA100%
Representative matchACGTACGTGCTAAGCAA100%
Near-neighbor reviewACGTACGTGCTATGCAA98.4%
Primer / Probe

Binding locations are shown for the target and close Candida relatives, including a primer-site polymorphism with an impact call.

OligosPrimer + probe
RiskSite impact
OutputExplained
Forward primerGCCTGTTTGAGCGTCRTTTCBinding
ProbeCCTCAAATCAGGTAGGAHTACCCGCTGReview
Reverse primerCCTCCGCTTATTGATATGCTTABinding
Mismatch position and hybridization ΔG°T contribute to the explained composite call.
Detection groups

Matched accessions are grouped into target, near-neighbor, and further-review classes for a clear species call.

GroupsTarget / off-target
ReviewGrouped
ExportReady
Detecting78%
Further review16%
Non-detecting6%
Grouped and deduplicated for review
Clade-stratified inclusivity

Coverage is organized by C. auris clade so meaningful sequence variation is visible instead of flattened into one percentage.

TargetC. auris clades
ExclusivityHaemulonii complex
MethodLive-alignment model
94%coverage
Primary target setDetected
Variant / clade setReview
Related sequence setExcluded
Variant impact

A primer-site polymorphism is grouped by impact so reviewers can see which change can affect detection.

ChangePolymorphism
ImpactReviewed
RecordCitable
3impact groups
RegionChangeImpact
Primer siteSNPReview
Probe regionMismatchSilent
AmpliconIndelImpact

Germline carrier screening Population-variation coverage across the ACMG 2023 100-variant CFTR carrier-screening context.

CFTR carrier screening

Static preview of an amplicon analysis framed around population variation and carrier-screening coverage.

TargetCFTR
ContextACMG-100
RecordVersioned
Analysis typeGermline carrier screening
TargetCFTR carrier screening
StatusComplete
RecordVersioned · timestamped
Primary resultPopulation-variation coverage across the ACMG 2023 100-variant CFTR carrier-screening context.
Population-variation alignments

Aligned population sequences make primer and probe binding coverage reviewable across the intended variant set.

ViewBase by base
CoveragePopulation set
FactorsVisible
SequenceIdentityCover
Query sequenceACGTACGTGCTATGCAA100%
CFTR carrier screening targetACGTACGTGCTATGCAA100%
Representative matchACGTACGTGCTAAGCAA100%
Near-neighbor reviewACGTACGTGCTATGCAA98.4%
Primer / Probe

The preview surfaces a population SNP under a primer site and shows the resulting dropout-risk assessment.

OligosPrimer + probe
RiskDropout review
OutputExplained
Forward primerGCCTGTTTGAGCGTCRTTTCBinding
ProbeCCTCAAATCAGGTAGGAHTACCCGCTGReview
Reverse primerCCTCCGCTTATTGATATGCTTABinding
Mismatch position and hybridization ΔG°T contribute to the explained composite call.
Detection groups

Variant-bearing sequences are grouped by expected amplification outcome, including a no-impact example for comparison.

GroupsDetected / review
ControlNo impact
ExportReady
Detecting78%
Further review16%
Non-detecting6%
Grouped and deduplicated for review
Ancestry-stratified coverage

Coverage is organized by population group to show where primer and probe design needs closer review.

TargetCFTR variants
ContextPopulation sets
MethodCoverage review
94%coverage
Primary target setDetected
Variant / clade setReview
Related sequence setExcluded
Dropout-risk analysis

Variants are grouped by impact, including the primer-site SNP that can create allele dropout and an explicitly silent result.

ChangePopulation SNP
ImpactDropout risk
ControlNo impact
3impact groups
RegionChangeImpact
Primer siteSNPReview
Probe regionMismatchSilent
AmpliconIndelImpact

Resistance marker Candida auris FKS1 analysis showing resistant versus wild-type discrimination and homolog exclusivity.

FKS1 resistance marker

Static preview of a resistance-marker run for C. auris, with resistant and wild-type sequence groups.

TargetC. auris FKS1
ContextResistance
RecordVersioned
Analysis typeResistance marker
TargetFKS1 resistance marker
StatusComplete
RecordVersioned · timestamped
Primary resultCandida auris FKS1 analysis showing resistant versus wild-type discrimination and homolog exclusivity.
Resistance-marker alignments

Alignments show the marker region and the mismatch factors contributing to the resistant or wild-type call.

ViewBase by base
CallComposite
FactorsVisible
SequenceIdentityCover
Query sequenceACGTACGTGCTATGCAA100%
FKS1 resistance marker targetACGTACGTGCTATGCAA100%
Representative matchACGTACGTGCTAAGCAA100%
Near-neighbor reviewACGTACGTGCTATGCAA98.4%
Primer / Probe

Oligo binding is checked against the marker sequence and related gene-family homologs.

OligosPrimer + probe
RiskCross-hybridization
OutputExplained
Forward primerGCCTGTTTGAGCGTCRTTTCBinding
ProbeCCTCAAATCAGGTAGGAHTACCCGCTGReview
Reverse primerCCTCCGCTTATTGATATGCTTABinding
Mismatch position and hybridization ΔG°T contribute to the explained composite call.
Detection groups

Sequences are grouped into resistant-marker, wild-type, and further-review classes.

GroupsResistant / wild type
ReviewGrouped
ExportReady
Detecting78%
Further review16%
Non-detecting6%
Grouped and deduplicated for review
Marker inclusivity

The target marker is reviewed across matched C. auris sequences while homologs are retained for exclusivity review.

TargetFKS1 marker
ExclusivityGene-family homologs
MethodCoverage review
94%coverage
Primary target setDetected
Variant / clade setReview
Related sequence setExcluded
Resistance variant impact

Marker changes are grouped by their effect on resistant versus wild-type discrimination, with the reasoning retained.

ChangeMarker variant
ImpactDiscrimination
RecordCitable
3impact groups
RegionChangeImpact
Primer siteSNPReview
Probe regionMismatchSilent
AmpliconIndelImpact
Why in silico

You can't wet-lab every variant. Nobody can.

Analytical specificity is a required performance characteristic for molecular assays: demonstrate the assay detects what it claims across the diversity of the target, and doesn't detect what it shouldn't. The problem is that the diversity keeps growing, and most of it never arrives as a culturable isolate, a reference material, or a characterized sample.

Read more

FDA has acknowledged this directly. In its special controls guideline for nucleic acid–based tuberculosis assays, the Agency states that in silico testing may be acceptable as an alternative for inclusivity testing for strains that are difficult to study. Across a growing set of molecular device classifications — including point-of-care and over-the-counter classifications finalized in mid-2026 — FDA writes the method into the special controls by name: a documented protocol for the continuous monitoring, identification, and handling of genetic mutations and novel isolates or strains, through regular review of published literature and periodic in silico analysis of target sequences to detect possible mismatches.

For laboratories, the same evidence sits under a different regulator. Establishing performance specifications for an LDT under CLIA requires analytical specificity, including interfering substances — and the same availability problem applies.

The logic holds outside infectious disease too. A carrier screening or oncology panel can lose an allele to a population SNP sitting under a primer binding site, and report a false homozygous result — a risk the ACMG and AMP standards for CFTR testing name explicitly. A veterinary or food-safety assay faces the same strain diversity with less reference material available. An NGS amplicon panel with four hundred primer pairs carries cross-hybridization risk no single-primer BLAST search will surface.

And it isn't a one-time exercise. Sequence databases grow continuously, and an assay evaluated against last year's database has not been evaluated against this year's. Recommended variant sets change too — ACMG replaced the 23-variant CF carrier screening panel with 100 variants in 2023, and every panel rebuilt to match needs its primer coverage rechecked. BLASTseq AI is built for the recurring version of this work: run it, score it, keep the record.

BLASTseq AI supports your analytical specificity assessment and monitoring activities; it does not discharge any regulatory obligation. In silico findings guide assay review and inform appropriate wet-lab evaluation. They do not replace laboratory validation. BLASTseq AI is not certified, approved, endorsed, or recognized by FDA, CMS, CAP, ACMG, AOAC, or any regulatory, professional, or accrediting body.

How it works

Three steps from sequence to record

Paste your sequence, or upload your whole multiplex panel

Drop in your primer, probe or amplicon sequence - or an existing assay design. No file wrangling, no setup.

> target: primer_fwd
> seq: GCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGG
> db: NCBI nt

BLASTseq AI runs BLAST, scores thermodynamics, and checks cross-reactivity

BLASTseq aligns against the live NCBI database, applies taxonomy-based filtering, and groups identical hits automatically.

running live NCBI alignment…
taxonomy filter applied
grouped & deduplicated

Get a record you can act on — or file

Inclusivity, exclusivity, and variant findings in a clean, shareable record — with the reference-database release and search date stamped in. Export it to your team, your design and development files, or your validation packet.

inclusivity and exclusivity scored
reference release and search date stamped
versioned report ready
Who it’s for

Built for teams behind molecular assays

Assay development scientists

Skip the manual BLAST-hit spreadsheet. Inclusivity, exclusivity, and dimer checks across your whole panel in one pass.

Clinical laboratories running LDTs

Establishing performance specifications means documenting analytical specificity. Generate that evidence — and the record behind it — against current sequence data.

NGS & germline panel developers

Screen hundreds of amplicons for cross-hybridization, and catch the population SNP under a primer site before it becomes a false homozygous call.

Regulatory & QA teams

Analytical specificity evidence generated as a byproduct of the run, in a form your design and development files can hold.

CDMOs & validation services

One defensible method across every client assay — and a record their QA team can file without rework.

Surveillance & public health

Screen assay coverage against emerging strains during active response, at response speed.

Early access feedback

Built with feedback from research and assay-development teams.

Privacy & data security

Your Scientific Data Stays Private and Under Your Control

Set your retention window at account setup

Assay Pro and Assay Teams users choose their retention period when they set up their account — up to 90 days on Assay Pro, up to 365 on Assay Teams. Basic runs are retained 7 days. Set it once; it applies to every run.

Your record, in your hands

Export or download any report you intend to keep on file. When a run reaches the end of its retention window, its reports go with it.

Every exported report is self-describing

Reference-database release, search date, query sequences, scoring parameters, and result rationale are captured in the report itself, so it stays interpretable and reproducible on your own systems long after the run is gone.

No AI training on your data

Sequences, results, and chat content are never used to train models. Encrypted in transit and at rest.

Pricing

Flexible plans for assay developers, manufacturers, and clinical laboratories

Start free and pay as you go, or subscribe for a monthly credit allowance. Pricing is per user. AI chat credits are charged based on the effort required for each interaction, while each structured report type costs 200 credits to unlock.

Basic
Best for researchers starting out.
$0/forever
Buy credits as you go
20 welcome credits on signup
Sign up free
  • Dashboard analytics
  • AI assistant access (credits)
  • Unlock reports with credits
  • 7-day run and analysis data retention
  • Share analysis runs
  • Monthly subscription credits
Assay Pro
For individual researchers running regular analyses.
$149per user / month
200 credits / month
20 welcome credits on signup
Start Assay Pro
  • Everything in Basic
  • 200 monthly credits included
  • Download grouped variant reports
  • Choose 7, 30, or 90 days of data retention
  • Buy additional credits anytime
  • Chat & email support
Assay Teams
For collaborative org workflows & shared reports.
$299per user / month
400 credits / month
20 welcome credits on signup
Start Assay Teams
  • Everything in Assay Pro
  • 400 monthly credits included
  • Share runs & reports across org
  • Each user can choose 7, 30, 90, 180, or 365 days of data retention
  • Higher credit allocation
  • Chat, email & phone support
Compliance Project Pack
For an assay-validation project.
$1,500
per assay-validation project
  • Inclusivity report
  • Exclusivity report
  • Variant-impact report
  • Multiplex dimer report
  • Bundled for one assay
Talk to sales
Regulatory / Enterprise
For organization-wide workflows and custom requirements.
From$24,000
per year per organization
Custom quote
  • Everything in Assay Teams
  • Organization-level engagement
  • Volume assay-validation support
  • Custom deployment and support options
  • 365-day data-retention option
Talk to sales

🎁 20 welcome credits on signup - plus an extra 200 bonus credits on your first purchase of 20+ credits.

FAQ

Questions & answers

Everything you need to know about how BLASTseq AI fits your workflow.

Browse all FAQs
What method do you use to score specificity?

Every hit is evaluated on three dimensions: sequence identity, mismatch location impact, and hybridization ΔG°T. These resolve into a single composite call, with the contributing factors shown so you can understand the result.

Who can use BLASTseq AI?

BLASTseq AI is used by molecular diagnostics manufacturers, assay developers, NGS and germline panel designers, CDMOs, clinical laboratories, and public health and surveillance teams to analyze and document the analytical specificity of primer, probe, and amplicon sequences. It's a development and quality-system tool, not a diagnostic device.

What types of analysis can it perform?

Inclusivity and exclusivity analysis; cross-reactivity screening; mismatch and variant impact assessment including primer-site dropout risk; multiplex dimer and cross-hybridization checking; taxonomy-based filtering; and accession grouping — for qPCR, dPCR, isothermal, and amplicon-based NGS assays.

Does BLASTseq AI work for NGS panels, or only PCR?

Both. Any assay that uses oligonucleotides to target a sequence — qPCR, dPCR, RT-PCR, isothermal amplification, amplicon-based NGS, hybrid capture, targeted enrichment. For large panels, the pairwise cross-hybridization check scales to several hundred amplicons, which is where manual review stops being feasible.

Does it work for germline and human genetic assays, or only pathogens?

Both. For a germline assay, the inclusivity question becomes coverage across population variation, and the highest-value output is identifying population SNPs under primer or probe binding sites — the cause of allele dropout and false homozygous calls. The CFTR carrier screening sample in the output showcase demonstrates this.

What kinds of targets does it handle?

Any sequence represented in the reference databases: bacterial, viral, fungal, and parasitic targets; resistance markers; human germline and somatic loci; veterinary, food-safety, and environmental targets. The method is the same regardless of what you're targeting.

Turn your next BLAST run into a record you can file.

Run a sample analysis — no signup required. Three pre-loaded examples: Candida auris identification, CFTR carrier screening, and an FKS1 resistance marker. Same workflow, three different assay types.